1000 збп: От чего зависят расценки за копирайтинг

Содержание

Услуги копирайтинга, низкая цена и семантическое ядро в подарок

Что из себя представляет копирайтинг? Банальный ответ – написание текстов для сайтов. Но если вы спросите профессионала в этом деле, что же такое копирайтинг, то он сможет прочитать вам не одну лекцию, из которых вы узнаете, что это все таки не примитивное написание текстов. Профессиональный копирайтер – это маркетолог, аналитик, психолог и писатель в одной личности. Необходимо написать такой текст, чтобы он был доступным, информативным, привлекающим.

Нуждаетесь в услугах копирайтера? Веб-студия Up-Site обеспечит вам тексты для вашего сайта. Мы создаем продающие тексты, ориентированные на целевую аудиторию, которые повысят ваши продажи. Наши тексты основываются на маркетинговом анализе сферы деятельности вашего бизнеса, тем самым информативность и смысловой акцент будет направлен на пользователя вашей целевой аудитории.

Ваши тексты будут:

  • грамотными, логичными; 
  • легкими для восприятия и по смысловой нагрузке;
  • уникальными;
  • оптимизированными под поисковые запросы.

Сотрудничество

Мы предлагаем три вида взаимодействия с клиентом:

  1. Мы сами подбираем темы, пишем тексты и высылаем вам проделанную работу.
  2. Мы выбираем темы, высылаем вам на согласование и после вашего ответа начинаем работу.
  3. Вы подбираете темы текстов, высылаете их нам и мы выполняем поставленную задачу.

Тарифы

Веб-студия UpSales предлагает гибкую систему тарифов на копирайтинг:

  1. Написание текстов до 10.000 знаков без пробелов (збп)  – 300грн/1000 збп
  2.  Создание текстов от 10.000 збп – 200грн/1000 збп
  3.  Создание текстов от 20.000 збп – 175грн/1000 збп
  4. При заказе текстов от 50.000 збп – 150грн/1000 збп + бонус – создание семантического ядра или расширение имеющегося.

Услуги копирайтера – цена за 1000 знаков в Украине и от чего она зависит

Рынок копирайтинга в Украине очень большой. Отечественные специалисты не только обслуживают внутренние потребности, но и предлагают свои услуги на иностранных площадках.

У любого заказчика закономерно возникает вопрос, какова цена услуг копирайтера за 1000 знаков в Украине.

Давайте попытаемся разобраться в этом. Поскольку здесь не все так очевидно, как кажется.

Если вас не интересуют детали, то ответим коротко:

  1. Копирайтинг цена за 1000 знаков Украина – в среднем 35-40 грн.
  2. Заказ текстов у опытных авторов – в среднем 60-100 грн за 1000 збп.

Цена копирайтинга за 1000 знаков в гривнах

В подавляющем большинстве случаев цена за тексты указывается в символах без пробелов или знаках без пробелов. На практике часто встречаются сокращенные обозначения – сбп или збп.

Но бывает и другой вариант – объем в знаках с пробелами. Если сравнивать первый и второй варианты, то с пробелами, очевидно, выходит больше.

А третья альтернатива – подсчет стоимости в словах. Применяется очень редко, поскольку этот критерий очень расплывчатый.

Условный украинский копирайтер за 1000 знаков (збп) предлагает большой диапазон цен. Начиная от 25 грн и дальше. Но такие минимальные цены доступны только у начинающих авторов, которые берутся за любое задание. Не стоит ожидать от этого сегмента удивительного качества, но бывают и исключения. При этом средние показатели на биржах колеблются в районе 35-45 грн. Профессиональные студии в среднем предлагают цены от 50 до 150 грн за 1000 символов.

1000 знаков это сколько?

Заказчики часто теряются и задаются этим вопросом. Если говорить о знаках без пробелов, то проще всего навести пример с страницей А4. Такой формат в среднем содержит 2 500 знаков без пробелов. То есть за страницу уникального текста, при цене 50 грн, придется заплатить 2,5 * 50 = 125 грн.

И практически нет никакой разницы, идет ли речь о тексте на русском или украинском языке.

От чего зависит цена текста копирайтера

Цена услуг копирайтера определяется несколькими главными аспектами:

  • Тематика. Чем более узкоспециализированная тема, которая требует высокого вовлечения и понимания нюансов, тем больше повышается стоимость работы автора. Текст о юриспруденции или технологии блокчейн будет стоит дороже статьи об отдыхе на Черном море или списке топ-10 комедий 2018 года.
  • Уникальность. Стоимость 1000 знаков уникального текста в гривнах (например, 95-100% по системам text.ru или advego) будет значительно выше, чем если по этому параметру не выдвигается особых требований
  • Оптимизация. Будут ли в тексте ключи, в каком количестве, пропорциях, склонениях и т. д. Есть ли дополнительные требования к особым параметрам текста: тошноте, водности, переспаму.
  • Дополнительные элементы. Некоторые заказчики устанавливают ряд правил относительно форматирования текста, его структуры и наличия специальных элементов (списков, подзаголовков и прочее).

Также очень сильно влияет на цену тип обработки текста:

  • Обычный рерайт с исходника – самый дешевый. Его реально заказать даже по 25-30 грн. На выходе заказчик должен получить текст с тем же смысловым содержанием, но уже написанный немного по-другому.
  • Авторская работа – уникальный текст, который предполагает плодотворный труд копирайтера в любом случае будет дороже.
  • А вот копирайтинг с SEO-оптимизацией – обойдется в цене

Цены на услуги копирайтеров студии PlagiArt

Авторы агентства копирайтинга PlagiArt предлагают своим клиентам и партнерам хорошие цены. Мы работаем в среднем ценовом сегменте и за предложенную суму создаем качественные и уникальные тексты.

Вы можете просмотреть цены на наши услуги.

За указанные деньги вы получите качественный контент, ответственное отношения наших специалистов и сдачу заказа вовремя!

На украинском рынке копирайтеры пишут 1000 знаков за разную стоимость. Поэтому вам самим лучше определить, подходит ли уровень автора с конкретным ценником. Мы же предлагаем вам опытных авторов за умную цену.

ᐈ Тексты на 1000 Знаков Киев — Цены 2021, Стоимость

Тексты на 1000 знаков в Киеве — инструмент для продвижения бизнеса в Интернете

Копирайтинг – настолько обобщающее понятие, что сейчас существует как минимум десять определений этого термина. В целом копирайтингом называют написание уникальных авторских текстов, которые должны выполнять различные функции. В классическом понимании речь идет только о рекламных текстах (первых рекламщиков в США называли копирайтерами), но сейчас это касается практически всех видов текстового контента.

Основные виды копирайтинга в Украине

В этом плане тоже нет однозначных данных: каждый специалист классифицирует копирайтинг по-своему. Если обобщить всю информацию, можно выделить такие категории:

  1. Интернет-копирайтинг. Это самый востребованный вид, представляющий собой написание текстов для сайтов (их еще называют текстовым контентом). Контент может быть разным: описательного характера, экспертный, продающий – все зависит от вида сайта.
  2. SEO-копирайтинг статьи. Это вид интернет-копирайтинга, особенностью которого является написание оптимизированных текстов – в них органически включены необходимые поисковые запросы. Такой контент позволяет продвигать страницы в поисковых системах.
  3. Рекламный копирайтинг. Это написание так называемых продающих текстов, которые можно использовать для рекламных рассылок, одностраничных сайтов, видеороликов, листовок и другой промо-продукции.
  4. Спичрайтинг. Его иногда относят к копирайтингу, хотя некоторые специалисты склоняются к тому, что это все-таки отдельная категория. Спичрайтинг представляет собой написание текстов выступлений, обращений и т.п.

Кому нужен копирайтинг?

Кто может стать заказчиком текстового контента? Проследить эту тенденцию позволяет любая современная биржа статей – сайт, где можно заказать услуги специалистов по написанию текстов. Основными заказчиками копирайтинга являются:

  • владельцы сайтов;
  • авторы блогов;
  • руководители компаний;
  • специалисты по рекламе;
  • SEO-оптимизаторы и др.

Практически любой сайт в Интернете нуждается в качественном текстовом наполнении. Современные тенденции поискового продвижения подтверждают актуальность контент-маркетинга: услуги копирайтеров и рерайтеров будут востребованы в ближайшей перспективе, так как основным качеством сайта считается наличие интересного и уникального авторского контента.

Как найти биржу копирайтеров?

Несложно догадаться, что работа копирайтером требует от автора не только грамотности. Он обязан разбираться в теме, так как должен создавать именно авторские тексты. Для рекламного копирайтинга важно знание основ маркетинга. Учитывая, что большинство копирайтеров работают удаленно, важны такие качества как ответственность и пунктуальность.

Прайс: Тексты на 1000 знаков в городе Киев

Цены на SEO копирайтингЦена за 1 тыс. символов
1-10 тыс. символов 80 грн.
10-30 тыс. символов 60 грн.
30-100 тыс. символов 50 грн.
Продающие тексты для сайтов 120 грн.
Тексты и статьи для журналов и газет 140 грн.
Наполнение сайтаЦена, грн
Создание страницы с текстом 8 грн.
Вставка изображения 7 грн.
Вставка таблицы 9 грн.
Страница сайта с текстом и изображением 15 грн.
Страница сайта с текстом и таблицей 17 грн.
Страница сайта с текстом, изображением и таблицей 24 грн.
Наполнение интернет-магазинаЦена, грн
50 товаров 750-900 грн.
100 товаров 1300-1500 грн.
200 товаров 2200-2600 грн.
более 200 товаров от 3000 грн.
Стоимость набора текстаЦена, грн
Набор рукописного текста 16 грн.
Набор печатного текста с формулами 25 грн.
Диаграмма/схема 20 грн.
Набор английского текста 15 грн.
Набор текста с аудио, видео материала 7 грн.
Расшифровка интервью/транскрибация 16 грн/мин

*Цена актуальная на Март 2021

Биржа фриланса Кабанчик позволяет заказать статью для сайта у проверенного исполнителя. Вы сами можете выбрать копирайтера по отзывам, портфолио и рейтингу. Также вам дана возможность предложить свою цену за услугу копирайта, установить точные сроки дедлайна, обсудить тонкости работы с потенциальными кандидатами.

API данных переписи: / data / 2018 / zbp / variables

EMP Количество сотрудников Все секторы: бизнес-модели почтовых индексов по классам размера занятости для 5-значного уровня почтового индекса: 2018 не требуется EMP_F 0 внутренний CB1800ZBP
EMP_N Диапазон шума для количества сотрудников Все секторы: Бизнес-модели почтовых индексов по классам размера занятости для 5-значного уровня почтового индекса: 2018 не требуется EMP_N_F 0 int CB1800
EMPSZES Размер сотрудников Все секторы: Бизнес-модели почтовых индексов по классам размера занятости для 5-значного уровня почтового индекса: 2018 не требуется EMPSZES_LABEL 0 строка CB
ESTAB Количество заведений Все секторы: Бизнес-модели почтовых индексов по классам размера занятости для 5-значного уровня почтового индекса: 2018 не требуется ESTAB_F 0 (не предикат) CB
для API переписи FIPS ‘для’ пункт Спецификация географии API переписи только для предикатов 0 fips-для N / A
GEO_ID Код географического идентификатора Все секторы: Бизнес-модели почтовых индексов по классу размера занятости для 5-значного уровня почтового индекса: 2018 не требуется GEO_ID_F, НАИМЕНОВАНИЕ 0 строка CB1800ZBP
GEOCOMP Компонент GEO_ID отображается по умолчанию 0 строка N / A
в API переписи FIPS ‘in’ пункт Спецификация географии API переписи только для предикатов 0 fips-in N / A
INDGROUP Отраслевая группа не требуется 0 строка N / A
INDLEVEL Уровень отрасли не требуется 0 int N / A
NAICS2017 2017 Код NAICS Все секторы: бизнес-модели почтовых индексов по классу размера занятости для 5-значного уровня почтового индекса: 2018 отображается по умолчанию NAICS2017_F, NAICS2017_LABEL, NAICS2017_F 0 строка CB1800ZBP
PAYANN Годовая заработная плата (1000 долларов США) Все секторы: бизнес-модели почтовых индексов по классам размера занятости для 5-значного уровня почтового индекса: 2018 не требуется PAYANN_F 0 int CB1800
PAYANN_N Диапазон шума для годовой заработной платы Все секторы: Бизнес-модели почтовых индексов по размеру занятости Класс для 5-значного уровня почтового индекса: 2018 не требуется PAYANN_N_F 0 int CB
PAYQTR1 Заработная плата за первый квартал (1000 долларов США) Все секторы: бизнес-модели почтовых индексов по классам размера занятости для 5-значного уровня почтового индекса: 2018 не требуется PAYQTR1_F 0 int
PAYQTR1_N Диапазон шума для расчета заработной платы за первый квартал Все секторы: Бизнес-модели почтовых индексов по классам размера занятости для 5-значного уровня почтового индекса: 2018 не требуется PAYQTR1_N_F 0 int int
СЕКТОР Экономический сектор НАИКС не требуется 0 строка N / A
ПОДСЕКТОР ПОДСЕКТОР не требуется 0 строка N / A
SUMLEVEL Сводный код уровня не требуется 0 строка N / A
ucgid Положение об идентификаторе единой географии переписи Спецификация географии API переписи только предикат 0 ucgid N / A
ГОД Год Все секторы: Бизнес-модели почтовых индексов по классу размера занятости для 5-значного уровня почтового индекса: 2018 не требуется 0 строка CB1800ZBP
ZIPCODE География не требуется 0 (не предикат) N / A

ЗИТ-1000, FMCE 6547, 711396, ЗБП-200, 116116

NSN> Производители запчастей NSN> Названия компаний начинаются с Z> Zefon International Inc. > ЗИТ-1000 — 116116

FSC 6530 Больничная мебель, оборудование, посуда и расходные материалы

FSC 6635 Проверка и проверка физических свойств

MFG SKU NSN Название позиции Подробная информация Код CAGE 20 9 RFQ40000 20 9 RFQ FMCE 6547
FMCE6547
6635-00-967-0500 Фильтрующий блок, Micropo Особенности: Целлюлозный материал; тип аэрозольной и гидрозольной установки; 47.0 мм диам. метки сетки не включены; Площадь фильтрации 9,6 см2; 0,65 абсолютная степень фильтрации в микронах; оловянный фильтрующий материал; белая впитывающая прокладка; белый цвет; крепление на обод не включено; 100 в коробке
0WB84

FSC 6665 Приборы и устройства для обнаружения опасностей

9039
MFG SKU NSN Название позиции
711396 6665-01-649-5374 Пробоотборный насос, воздух III Название детали Назначено Контролирующим агентством: Escort elf пробоотборный насос
Особенности: 5 станций 120 / 240V
0WB84
ZBP-200
ZBP200
6665-01-645-8188 Насос для отбора проб, воздух Общая длина: 8.0 дюймов номинал
Общая высота: 2,75 дюйма номинал
Общая ширина: 4,375 дюйма номинальная
0WB84

FSC 6680 Приборы для измерения расхода жидкости и газа, уровня жидкости и механического движения

. 0 дюймов номинально
Тип входного соединения: шланговый ниппель
Встроенный предохранительный клапан: не входит в комплект
MFG SK NSN Название позиции Подробности Код CAGE RFQ
116116 6680-01-624-0894 Счетчик, длина с указанием расхода4 0WB84

Антитело против ZP4 / ZBP | Кроличьи поликлональные IHC против человека, WB

добавить отзыв LSBio Гарантия

Антитела:

.

ZP4 / ZBP Кроличьи поликлональные (aa445-474) антитела человека

Приложение:

IHC, IHC-P, WB

Формат:

Несопряженный, Немодифицированный

Международный 206-374-1102

Только для исследовательских целей

Обзор

Антитела:

.

ZP4 / ZBP Кроличьи поликлональные (aa445-474) антитела человека

Приложение:

IHC, IHC-P, WB

Формат:

Несопряженный, Немодифицированный

Характеристики

Описание

ZBP-антитело LS-C160968 представляет собой неконъюгированное кроличье поликлональное антитело к ZBP человека (ZP4) (aa445-474).Проверено для IHC и WB.

Цель

ZP4 / ZBP человека

Синонимы

ZP4 | Белок Zona pellucida B | Zona pellucida гликопротеин 4 | Зп-4 | Zona pellucida, белок B | ZBP | ZPB

Реакционная способность

Человек (проверено или 100% идентичность иммуногенной последовательности)

Спряжение

Несопряженный

Очистка

Белок А очищенный

Специфичность

Это антитело к ZP4 получают от кроликов, иммунизированных синтетическим пептидом, конъюгированным с KLH, между 445-474 аминокислотами из С-концевой области ZP4 человека.

Приложения

  • IHC
  • IHC — Парафин (1:10 — 1:50)
  • Вестерн-блоттинг (1: 1000)
Выполняете IHC? Ознакомьтесь с нашей полной линейкой реагентов для иммуногистохимии, включая растворы для извлечения антигенов, блокирующие агенты. Наборы для обнаружения ABC и полимеры, биотинилированные вторичные антитела, субстраты и многое другое.

Презентация

PBS, 0,09% азид натрия

Хранилище

Хранить в холодильнике при температуре от 2 ° C до 8 ° C до 6 месяцев. Для длительного хранения хранить при -20 ° C.

Ограничения

Только для исследовательских целей. Предназначен для использования профессионалами лаборатории.

Гарантия

На это антитело распространяется 100% гарантия LSBio.

LSBio Гарантия

Публикации (0)

Отправить публикацию для LS-C160968

Отзывы клиентов (0)

Отправить обзор LS-C160968

Рекомендуемые товары

Реактивность: Человек

Классифицировать: 46. 88-3000 пг / мл

Реактивность: Мышь

Классифицировать: 0,16-10 нг / мл

Разновидность: Человек

Приложения: Проточная цитометрия, функциональный анализ

Источник: Э.кишечная палочка

Тег: His-T7

Разновидность: Человек, Обезьяна

Приложения: IHC, IHC — Парафин

Реактивность: Человек

Классифицировать: 3.12-200 нг / мл


Запрос паспорт безопасности данных

Чтобы запросить форму SDS / MSDS для этого продукта, свяжитесь с нашим отделом технической поддержки по телефону:

Technical. [email protected]

Запрошен из: Российская Федерация
Дата запроса: 18.03.2021

Функция ZBP-89 в стволовых клетках толстой кишки и во время индуцированного бутиратом старения фактор транскрипции типа «цинковые пальцы», связывающий GC-богатые элементы ДНК [1, 2].Ранее мы показали, что ингибирование гистондеацетилазы (HDACi), например, бутиратом или трихостатином A (TSA), способствует индукции ZBP-89

CDKN1B ( p21 Waf1 ) и его белок-белковое взаимодействие с белками-супрессорами опухолей p53. , мутировавшая атаксия и телеангиэктазия (ATM) и p300, гистонацетилтрансфераза (HAT) [2-4]. Кроме того, ZBP-89 опосредует репрессию транскрипции генов виментина и CDKN2A ( p16 INK4A ) путем рекрутирования HDAC на их промоторы [5-7].ZBP-89 индуцирует триптофангидроксилазу ( Tph2 ) за счет синергизма с β-катенином и способствует защите слизистой оболочки против S. typhimurium [8]. Установив, что ZBP-89 и β-катенин взаимодействуют в нормальной реституции слизистой оболочки толстой кишки, мы протестировали и обнаружили, что ZBP-89 способствует образованию кишечных полипов, инициированных делецией локуса Apc [9].

Условная делеция локуса Zfp148 в эпителиальных клетках кишечника снижала ожидаемое количество полипов тонкого кишечника в мышиной модели удаленного Apc, демонстрируя, что ZBP-89 необходим для β-катенин-зависимого образования полипов [9] .Мы обнаружили, что β-катенин связывается с промотором ZNF148 , стимулируя экспрессию гена ZBP-89. Аналогичным образом, белок ZBP-89 связывается с промотором CTNNB1 ( β- катенин ), индуцируя транскрипцию β-катенина. Таким образом, ZBP-89 вносит вклад в петлю экспрессии гена с прямой связью, которая может поддерживать повышенные уровни β-catenin, когда и там, где передача сигналов Wnt высока [9], например, в нише нормальных стволовых клеток и при раке толстой кишки. Соответственно, мы также показали, что экспрессия ZBP-89 коррелирует с плохой выживаемостью после хирургической резекции по поводу колоректального рака и что экспрессия белка ZBP-89 повышена при колоректальном раке (CRC) [9].

Как в кишечнике, так и в толстой кишке передача сигналов Wnt наиболее высока в основании желез или крипт, что указывает на то, что ZBP-89 может играть важную роль в нише стволовых клеток. Чтобы напрямую проверить эту гипотезу, мы изучили экспрессию и функцию ZBP-89 в стволовых клетках кишечника и толстой кишки и обнаружили, что фактор транскрипции экспрессируется в базальных столбчатых клетках крипт (CBC), которые в конечном итоге дифференцируются и повторно заселяют железы тонкой и толстой кишки. . Более того, ZBP-89 также необходим для роста полипов в толстой кишке гемизиготных мышей Apc (Cdx2Cre: Apc FL / + ) .Чтобы изучить влияние общего бактериального метаболита на поддержание стволовых клеток, органоиды толстой кишки, полученные из толстой кишки дикого типа (WT) и Cdx2Cre: Apc FL / + толстой кишки мыши культивировали в присутствии короткоцепочечной жирной кислоты (SCFA). ) бутират. Мы обнаружили, что органоиды, полученные из Cdx2Cre: Apc FL / + толстой кишки, сохраняют свой фенотип стволовых клеток в присутствии бутирата. Однако удаление Zfp148 уменьшало рост органоидов толстой кишки и позволяло органоидам стареть.В совокупности наши результаты демонстрируют, что ZBP-89 играет роль в дифференцировке стволовых клеток во время гомеостаза и трансформации благодаря своей способности подавлять старение.

РЕЗУЛЬТАТЫ

Белок ZBP-89 высоко экспрессируется в ОАК и транзитно-амплифицирующих (ТА) клетках

Чтобы определить расположение на слизистой оболочке экспрессии белка ZBP-89 в просвете желудочно-кишечного тракта, мы провели иммуногистохимию (ИГХ) на ткани из тонкий кишечник (двенадцатиперстная кишка, тощая и подвздошная кишка) и толстая кишка (проксимальный и дистальный отдел толстой кишки). В тонком кишечнике белок ZBP-89 экспрессировался в основном в транзитно-амплифицирующих (ТА) клетках и в рассеянных клетках у основания крипт (рис. 1А). Экспрессия уменьшилась на кончике ворсинок, где стареющие клетки выпадают в просвет. В слепой кишке и толстой кишке (проксимальной и дистальной) ZBP-89 экспрессируется в нижних двух третях основания толстой железы (рис. 1В). Кроме того, ZBP-89 является повсеместным белком, который также высоко экспрессируется в иммунных клетках [10, 11], что объясняет экспрессию в рассеянных клетках собственной пластинки.

Фигура 1: ZBP-89 высоко экспрессируется в CBC и ТА-клетках. Репрезентативные изображения иммуногистохимии для ZBP-89 в тонкой кишке (A), и толстой кишке (B), . (C) Zfp148 in situ гибридизация в тонком кишечнике. Смысловой зонд использовали в качестве отрицательного контроля. Шкала шкалы = 100 мкм. Вставка CBC на 200 мкм

Чтобы локализовать мРНК Zfp148 , мы выполнили in situ гибридизацию (ISH) в тонком кишечнике и обнаружили, что самый высокий уровень экспрессии мРНК происходит в основании крипты (рис. 1С).Разбросанные клетки в собственной пластинке также экспрессировали мРНК Zfp148 , что согласуется с ее известной экспрессией в иммунных клетках (Рисунок 1) [10].

Линия линии клеток Zfp148 + в тонком и толстом кишечнике

Поскольку мРНК Zfp148 экспрессировалась в основании крипт в CBC, мы получили линию Zfp148Cre ERT2 из клона BAC, содержащего 250 kb. промотор Zfp148 для клонирования отслеживает его экспрессию. Гибридным мышам Zfp148: tdTomato вводили одну дозу тамоксифена (Tx), а затем умерщвляли через 24 часа, 3 дня, 1 неделю и 3 недели после инъекции.Через 24 часа после инъекции Tx Zfp148 положительных клеток располагались в основании крипт тонкой кишки и толстой кишки (рис. 2A, 2E). К 3-му дню, основание кишечной крипты и транзитно-амплифицирующие (ТА) клетки были последовательно помечены (фиг. 2B, 2F). Через 7 дней после инъекции клетки tdTomato + (tdT pos ) заселяли не только крипты и зону ТА, но также меченые рассеянные клетки на концах ворсинок (рис. 2C, 2G). Через 3 недели Zfp148 положительных клеток сформировали полосы вдоль всей ворсинки и толстой кишки (рис. 2D, 2H).Как ранее наблюдалось для репортера Lgr5-EGFP-Cre ERT2 [12], мы также обнаружили, что плазмида Zfp148Cre ERT2 также генерировала разнообразные линии происхождения. В то время как пестрота может указывать на гетерогенность стволовых клеток, недавние модификации исходного репортера Lgr5 ( Lgr5-2A-EGFP-CreERT2 ) привели к отслеживанию неоднородных клонов, что указывает на то, что неоднородная экспрессия связана со стабильностью транскриптов [13]. Кишечные железы собирали через 24 часа после инъекции Tx у химерных мышей Zfp148: tdT и культивировали в течение 10 дней в Matrigel для получения органоидов Zfp148: tdT pos .Через два дня после культивирования несколько клеток Zfp148: tdT pos были видны в сферических органоидах (рис. 2I). К 3 дню клетки Zfp148: tdT pos локализовались в зачатках крипт и на ворсиноподобном домене (рис. 2J). На 7-й и 10-й день клетки Zfp148: tdT pos преимущественно располагались в криптоподобных структурах и в просвете органоида (рис. 2K, 2L). Таким образом, мы пришли к выводу, что клетки Zfp148: tdT pos высоко экспрессируются в стволовых клетках CBC и могут повторно заселять ворсинки целиком, что указывает на то, что ZBP-89 играет роль как в стволовых клетках кишечника, так и в стволовых клетках толстой кишки.

Фигура 2: Трассировка линии Zfp148 в тонком и толстом кишечнике мыши. Репрезентативные изображения следа линии Zfp148 с использованием химерных мышей Zfp148: tdTomato , внутрибрюшинно инъецированные одной дозой тамоксифена 0,1 мг / г массы тела (Tx). Тонкий кишечник исследовали через 24 часа (A) , 3 дня (B) , одну неделю (C) и три недели (D) . Ободочную кишку исследовали через 24 часа (E) , 3 дня (F) , одну неделю (G) и три недели (H) . (I-L) Конфокальные изображения органоидов кишечника, культивированных в течение 10 дней после создания из мыши Zfp148: tdTomato , инъецированной одной дозой тамоксифена и подвергнутой эвтаназии через 24 часа. N = 4 мышей анализировали за один момент времени. Масштабная линейка = 100 мкм.

Zfp148 положительные клетки образуют органоиды тонкой кишки и толстой кишки

Для дальнейшей оценки функции ZBP-89 в стволовых клетках тонкой кишки и толстой кишки отдельные клетки tdT pos были отсортированы из клеточной суспензии слизистой оболочки тонкого или толстого кишечника 24 часа после инъекции Tx (рис. 3A).Клетки Zfp148tdT pos и Zfp148tdT neg , выделенные из кишечника и толстой кишки, повторно суспендировали в матригеле и культивировали в полной среде. Только клетки, отсортированные по Zfp148tdT pos , были способны образовывать органоиды (рис. 3В). Таким образом, клетки Zfp148- tdT + как из кишечника, так и из толстой кишки генерировали почкующиеся органоиды, которые продолжали экспрессировать репортер tdTomato (рис. 3В). Чтобы изучить функцию ZBP-89 в стволовых клетках Lgr5 + CBC, локус Zfp148 был удален путем обработки Lgr5Cre ERT2 : Zfp148 FL / + и Lgr5TfCre 906 FL / FL химерные органоиды мыши с 4OH-Tx после 3 дней культивирования.После 48 часов обработки 4OH-Tx количество органоидов Lgr5Cre ERT2 : Zfp148 FL / FL было значительно снижено по сравнению с Cre Negative (CreNeg) и Lgr5Cre ERT2 : Zfp148 (Рисунок 3C). В совокупности эти результаты продемонстрировали, что Zfp148 играет критическую роль в выживании как кишечных, так и толстых стволовых клеток.

Рисунок 3: Сортировка одной клетки Zfp148: tdTomato + клеток и делеция Zfp148 в стволовых клетках. (A) Одноклеточная сортировка Zfp148: tdTomato положительных клеток из тонкой и толстой кишки. Ворота флуоресцентных клеток, выделенных из CreNeg, по сравнению с мышами Zfp148Cre ERT2 + через 24 часа после одной дозы Tx (0,1 мг / г массы тела). Показан средний процент ± SEM для tdTomato + отсортированных клеток от N = 3 мышей на ткань на каждый генотип. (B) Репрезентативные изображения отсортированных клеток, культивируемых в матригеле после 3 дней культивирования. (C) График, показывающий общее количество органоидов тонкой кишки в день.Показано среднее значение ± SEM. *** P < 0,0001 ANOVA с множественными сравнениями Тьюки. N = 3 пассажей органоидов, взятых у 3 мышей и культивированных в трех экземплярах за каждый момент времени. Стрелка указывает на добавление 4-OH-Tx, добавленного после того, как органоиды находились в культуре в течение 3 дней. Масштабные линейки = 100 мкм.

Делеция Zfp148 снижает онкогенез Cdx2: Apc FL / + толстой кишки мыши

Чтобы оценить влияние ZBP-89 на полипы толстой кишки, опосредованные Apc , мы создали Cdx2Cre : Cdx2Cre : / + : Zfp148 FL / FL гибридные мыши.У мышей Cdx2Cre : Apc FL / + [14] через 5 месяцев развилось в среднем 15 полипов на толстую кишку, распределенных по проксимальному и дистальному отделам толстой кишки (рис. 4A-4C). Количество полипов толстой кишки у мышей Cdx2Cre: Apc FL / + было в ~ 4 раза больше, чем то, что мы наблюдали, когда трансген VillinCre использовался для удаления Apc [9]. У мышей Cdx2Cre : Apc FL / + потеря одного или обоих аллелей Zfp148 снизила количество полипов толстой кишки на 80% (рис. 4C).Более того, расположение полипов, которые действительно возникли, было более дистальным у мышей Cdx2: Apc FL / + , несущих локусы Zfp148 (рис. 4D), и размер полипа был значительно уменьшен, когда аллели Zfp148 были удалено (рис. 4E).

Рисунок 4: Удаление Zfp148 уменьшает полипы толстой кишки у мышей Cdx2: Apc FL / + . (A) H&E швейцарских рулетов из толстой кишки мыши от Cre Negative; Cdx2: Apc FL / + ; Cdx2: Apc FL / + : Zfp148 FL / + и Cdx2: Apc FL / + : Zfp148 FL / FL как указано.Шкала шкалы = 200 мкм. (B) Репрезентативные изображения ИГХ ZBP-89 в толстой кишке мышей показаны в (A) . Масштабные линейки = 200 мкм. (C) Количество полипов указанных генотипов на мышь. Показаны средние значения ± SEM. N = 9 мышей на генотип ** P < 0,001, тест ANOVA Kruskal-Wallis. (D) Распределение расположения полипов в процентах от общего количества полипов на генотип. Число в скобках соответствует общему количеству полипов, идентифицированных для этого генотипа у 9 мышей. (E) Распределение размера полипов в процентах от общего количества полипов на генотип.

Делеция Zfp148 позволяет дифференцироваться органоидом толстой кишки

Чтобы напрямую проверить эффект удаления Zfp148 в гемизиготных Apc стволовых клетках толстой кишки, органоиды были получены из толстой кишки Cdx2Cre : FL мышей, которые показали морфологию нерастущих стволовых клеток (сферические органоиды, рис. 5А).Однако потеря одного или обоих аллелей Zfp148 была достаточной, чтобы вызвать морщинистый вид через 3 дня культивирования, которые к 7-му дню переросли в маленькие почки (рис. 5A, 5B, 5D). Когда оба аллеля Zfp148 были удалены, органоиды проявляли обширное почкование, демонстрируя, что ZBP-89 необходим для поддержания стволовости. Хотя потеря одного или обоих аллелей Zfp148 в условиях удаленного Apc, уменьшала образование полипов, это не влияло на степень пролиферации органоидов, определяемую включением EdU (фиг. 5C, 5E).Хотя ZBP-89 необходим для поддержания ниши стволовых клеток и кооперируется с передачей сигналов Wnt, отсутствие эффекта на пролиферацию клеток указывает на то, что синергизм с передачей сигналов Wnt влияет на другие потребности в поддержании стволовых клеток. Таким образом, мы исследовали несколько мишеней Wnt и обнаружили, что делеция Zfp148 в толстой кишке снижает экспрессию двух прямых генов-мишеней Wnt Lgr5 и Axin2 , согласованную синергию между ZBP-89 и β-катенином.Хотя Reg4 ген-мишень Wnt модулировался делецией Zfp148 , он также регулируется факторами транскрипции Cdx2 и Gata 6 [15-17]. Уровни мРНК β-катенина не изменились, что, возможно, отражает установившиеся уровни белка, которые достигаются после того, как органоиды закрепляются. Удаление Zfp148 также уменьшило Notch2 , что свидетельствует о некотором перекрестном взаимодействии с сигнальным путем Notch (рис. 5F).

Рисунок 5: Делеция Zfp148 индуцирует дифференцировку клеток в органоидах Cdx2: Apc FL / + . (A, B) Изображения морфологии органоидов толстой кишки для каждого генотипа через 2 и 7 дней культивирования (Cre Neg .; Cdx2: Zfp148 FL / FL ; Cdx2: Apc FL / + ; Cdx2: Apc FL / + : Zfp148 FL / + и Cdx2: Apc FL / + : Zfp148 FL / Fl ). (C) Конфокальные изображения включения EdU в генотип после 3 дней культивирования. Шкала шкалы = 100 мкм. (D) Средний процент ± SEM для морфологии органоидов на все структуры (органоиды / сфероиды) на 2, 3, 5 и 7 день после культивирования в Matrigel в трех повторностях для трех пассажей от 3 мышей на каждый генотип. (E) Средний процент ± SEM ядер EdU + с использованием 2-3 органоидов на изображение. Были количественно оценены пять изображений для каждого генотипа для каждого состояния. (F) КПЦР с использованием трех пассажей органоидов на генотип. Показаны средние значения ± SEM, **** P <0,0001 *** P < 0,001, ** P < 0,005, * P < 0,05 с помощью двустороннего дисперсионного анализа Тьюки Тест множественных сравнений.

ZBP-89 предотвращает ингибирование роста, вызванное бутиратом, органоидов, удаленных

Apc

В отличие от тонкой кишки, опухоли в толстой кишке возникают в присутствии комменсальных бактерий, которые ферментируют углеводы до миллимолярных количеств бутирата, короткоцепочечной жирной кислоты (SCFA) с наиболее мощной ингибирующей активностью HDAC [18, 19].Культивирование органоидов обычно проводят в отсутствие бутирата или бактерий. Действительно, бутират обычно подавляет рост клеток толстой кишки, что может объяснить стойкую пролиферацию органоидов, несущих мутантный аллель Apc (Рисунок 5). Поэтому мы исследовали, влияет ли добавление бутирата к органоидным культурам на их рост. Органоиды толстой кишки как от WT (CreNeg), так и от Cdx2Cre: Zfp148 FL / FL мышей обрабатывали 0,5 мМ бутирата, что индуцировало значительное увеличение апоптотических клеток и подавляло пролиферацию клеток по сравнению с группой без бутирата (рис. 6А, 6Б).В этих условиях органоиды толстой кишки, несущие делецию Apc ( Cdx2Cre: Apc FL / + ) , сохраняли свою сфероидальную форму и процветали в присутствии бутирата (0,5 мМ), даже несмотря на то, что те же концентрации бутирата плохо переносились нормальные органоиды толстой кишки (рис. 6C, 6D). Однако делеция Zfp148 ( Cdx2Cre: Apc FL / + : Zfp148 FL / FL ) уменьшала пролиферацию органоидов в присутствии бутирата (рис. 6E, 6F), но не было значительного увеличения апоптоза ( Рисунок 6G), предполагая, что потеря Zfp148 в присутствии бутирата может инициировать клеточное старение (остановку роста) в отличие от апоптоза [20]. Напротив, кишечные органоиды проявляли большую чувствительность к бутирату (рис. 7A-7E). Старение наблюдалось в Apc и Apc плюс Zfp148 -удаленных кишечных органоидах даже при 0,1 мМ бутирата, в то время как Cre Neg и Zfp148 -удаленные органоиды без делеции Apc уже были апоптозными. концентрация бутирата (рис. 7F).

Рисунок 6: ZBP-89 защищает мутантные органоиды Apc от обработки бутиратом. (A, B) Репрезентативные изображения Cre Neg; Cdx2: Zfp148 FL / FL Морфология органоидов толстой кишки после добавления 0,1 мМ и 0,5 мМ бутирата в культуральную среду органоидов (C, D) Cdx2: Apc FL / + : Zfp148 FL 90/682 + и Cdx2: Apc FL / + : Zfp148 FL / Fl органоиды после обработки бутиратом. (E) Количество органоидов на генотип и на концентрацию бутирата для трех пассажей органоидов, культивируемых в трех экземплярах на генотип.Показаны средние значения ± SEM. *** P = 0,001 с использованием двустороннего дисперсионного анализа с тестом множественных сравнений Сидака. (F) Средний процент ± SEM ядер EdU + из 2-3 органоидов толстой кишки на изображение из пула из 3 мышей на генотип. ** P < 0,001 и *** P < 0,0001 по данным двустороннего дисперсионного анализа множественных сравнений Тьюки. (G) TUNEL анализ, показанный как процент TdT-положительных клеток для каждой популяции на количество DAPI-положительных клеток. * P < 0,05, ** P < 0,001 и *** P < 0,0001 по результатам двухфакторного дисперсионного анализа множественных сравнений Тьюки.

Рис. 7. Органоиды кишечника проявляют большую чувствительность к бутирату, чем органоиды толстой кишки. Типичные изображения кишечных органоидов, окрашенных на активность связанной со старением бета-галактозидазы (SA-βGal) до и после обработки увеличивающимися концентрациями бутирата. (A) Cre Neg., (B) VillinCre: Zfp148 FL / FL , (C) VillinCre: Apc FL / + и (D) VillinCre: Apc Zf ФЛ / Ф . Шкала шкалы = 100 мкм. (E) Спектрофотометрическое количественное определение активности кишечных органоидов SA-βGal по A 460 . (F) Анализ TUNEL , показанный как процент TdT-положительных клеток для каждой популяции на количество DAPI-положительных клеток. * P < 0.05, ** P < 0,001 и *** P < 0,0001 по данным двустороннего дисперсионного анализа множественных сравнений Тьюки.

Чтобы проверить, проявляют ли органоиды толстой кишки ZBP-89 клеточное старение, мы определили уровни SA-βGal в культурах органоидов, обработанных увеличивающимся количеством бутирата (0, 0,1, 0,5 мМ) (фиг. 8). Мы обнаружили, что органоиды CreNeg и Cdx2Cre: Zfp148 FL / FL были стареющими и впоследствии апоптозными с увеличением концентрации бутирата (рис. 8A, 8B, 8E).Напротив, органоиды, полученные из Cdx2CreApc FL / + , не подвергались старению, если не был удален Zfp148 (фиг. 8C-8E). Поскольку старение опосредуется циклин-зависимым ингибитором Cdkn2a [20], мы определили уровни его экспрессии, используя РНК, экстрагированную из органоидов до и после обработки бутиратом. Действительно, мы обнаружили значительное увеличение мРНК Cdkn2a с делецией Zfp148 , но более резко, когда органоиды обрабатывались бутиратом (фиг. 8F, 8G).Удивительно, но бутират сильно подавлял экспрессию гена Zfp148 , способствуя увеличению Cdkn2a (фиг. 8F, 8G).

Фиг. 8: Потеря Zfp148 в присутствии бутирата инициирует клеточное старение в органоидах Apc FL / + . Репрезентативные изображения органоидов толстой кишки, окрашенных на активность связанной со старением бета-галактозидазы (SA-βGal) до и после обработки увеличивающимися концентрациями бутирата (A) Cre Neg. , (B) Cdx2Cre: Zfp148 FL / FL , (C) Cdx2Cre: APc FL / + и (D) Cdx2Cre: FL / ЭП / ЭП . Шкала шкалы = 100 мкм. (E) Спектрофотометрическая количественная оценка активности SA-βGal органоидов толстой кишки по A 460 . (F) КПЦР для Cdkn2a и Zfp148 с использованием трех пассажей CreNeg и Cdx2: Zfp148 FL / FL органоидов толстой кишки, инкубированных с 0.1 мМ бутират. (G) кПЦР для Cdkn2a и Zfp148 с использованием трех проходов Cdx2: Apc FL / + : Zfp148 FL / + и FL681: FL681: FL681 Zfp148 FL / Fl органоиды толстой кишки, инкубированные с 0,5 мМ бутирата. * P < 0,05, ** P < 0,001 и *** P < 0,0001 по результатам двухфакторного дисперсионного анализа множественных сравнений Тьюки.

Feng et al. Ранее было показано, что ZBP-89 непосредственно связывается и репрессирует промотор CDKN2A в клеточной линии рака легкого путем рекрутирования HDAC [6]. Таким образом, чтобы определить, регулирует ли бутират связывание ZBP-89 с промотором Cdkn2a , мы выполнили Chip-Seq с использованием клеток STC-1, линии кишечных клеток мыши, и обнаружили, что связывание ZBP-89 с промотором Cdkn2a мыши снижается ( Рисунок 9А). Чтобы определить, индуцировало ли подавление бутирата связывания ZBP-89 экспрессию и старение гена CDKN2A в линиях клеток рака толстой кишки, линию клеток CRC SW480 обрабатывали бутиратом в течение 1, 3 и 16 часов.ChiP-qPCR показала, что бутират снижает связывание ZBP-89 с промотором CDKN2A (фиг. 9B), что соответствует увеличению экспрессии гена CDKN2A в SW480 в дополнение к клеточным линиям Caco-2 и HT-29 (фиг. 9C). , 9D). Чтобы определить, соответствовало ли увеличение экспрессии CDKN2A ( p16 INK4A ) подавлению экспрессии гена ZBP-89 в линиях клеток толстой кишки (SW480, Caco-2 и HT-29), был сбит ZNF148 вниз с использованием олигонуклеотидов siRNA. Действительно, CDKN2A был значительно индуцирован и соответствовал пониженной экспрессии мРНК ZNF148 (фиг. 9E, 9F). Следовательно, как наблюдалось в нашей модели на мышах, бутират индуцирует экспрессию гена CDKN2A и предположительно клеточное старение благодаря своей способности подавлять экспрессию гена ZNF148 .

Фигура 9: Бутират снижает связывание ZBP-89 с промотором мыши и человека p16 Ink4a . (A) ChIP-Seq клеток STC-1 мыши, обработанных 2.5 мМ бутирата в течение 6 часов. Хроматин, осажденный антителом ZBP-89, анализировали в браузере GRC m38 / mm10 генома UCSC. (B) Иммунопреципитация хроматина клеток SW480, обработанных бутиратом в течение 1, 3 и 16 часов. Заселенность промотора CDKN2A ZBP-89, определенная с помощью qPCR, была нанесена на график как функция входного сигнала. (C) Клетки SW480, Caco-2 и HT-29, обработанные бутиратом в течение 1, 3 и 16 часов, анализировали с помощью qPCR на мРНК CDKN2A и (D) ZNF148 мРНК. (E) Клетки SW480, Caco-2 и HT-29, инкубированные в течение 24 часов с ZNF148, siRNA или siRNA scrambled control oligo, а затем обработанные бутиратом в течение 1, 3 и 16 часов, были проанализированы с помощью qPCR на CDKN2A mRNA и (F) мРНК ZNF148 . Показаны средние значения ± SEM, **** P < 0,0001, *** P < 0,001, ** P < 0,05, по результатам однофакторного теста множественных сравнений ANOVA.

ОБСУЖДЕНИЕ

Исследования, представленные здесь, демонстрируют, что ZBP-89 экспрессируется в CBC и играет роль в поддержании стволовых клеток и клеточной дифференцировке.Мы недавно сообщили, что ZBP-89 синергетичен с передачей сигналов Wnt, непосредственно индуцируя экспрессию гена β-catenin [9]. Следовательно, увеличение экспрессии гена, опосредованной ZBP-89, поддерживает повышенные уровни этого протоонкогена. Напротив, β-катенин индуцирует экспрессию ZNF148 [9]. Как предполагалось ранее [9], прямая регуляция этих двух факторов транскрипции вносит значительный вклад в управляемую Wnt трансформацию как из кишечных, так и из толстых стволовых клеток [21]. В частности, мы показываем здесь, что все меньше и меньше полипов образовалось, когда оба локуса Zfp148 и Apc были условно удалены с использованием специфичного для толстой кишки трансгена Cdx2Cre . Zfp148 делеция соответствовала усиленному отрастанию органоидов, что указывает на потерю стволовых клеток, что предположительно замедляет трансформацию ниши стволовых клеток толстой кишки. Удивительно, но ни делеции Zfp148 , ни только бутирата было недостаточно для ингибирования пролиферации органоидов в контексте удаленного локуса Apc , но вместо этого они действовали синергетически, подавляя фенотип стволовых клеток.

Ингибиторы HDAC, такие как бутират, вызывают клеточное старение за счет увеличения количества циклинзависимых ингибиторов, например.г., p21 waf1 , p16 INK4 [22-24]. В толстой кишке уровни бутирата самые низкие в дистальном отделе толстой кишки и глубоко внутри крипт, вдали от просветных бактерий [18, 19]. Ранее мы показали, что ZBP-89 напрямую связывает промотор p21 waf1 и усиливает индукцию бутирата этого циклин-зависимого ингибитора, который также является генной мишенью для нескольких регуляторов транскрипции, включая p53 и cMyc [2]. Хотя ZBP-89 формирует межбелковое взаимодействие с p53 и предотвращает его ядерный экспорт и деградацию в цитоплазме [3], значение взаимодействия in vivo и не было очевидным.Возможный механизм заключался в регуляции индукции p53 p21 waf1 и последующем клеточном старении. Недавно Lindahl с соавторами сообщили, что ZBP-89 блокирует развитие мутантного полипа Apc в кишечнике путем ингибирования р53-опосредованной активности [25]. Они не наблюдали никакого эффекта на пролиферацию клеток или апоптоз в ранних кишечных опухолях и предположили, что снижение инициации опухоли было связано с изменением судьбы клеток. Здесь мы демонстрируем, что бутират, связанный с делецией Zfp148 , необходим для значительного перехода в стареющую фазу замедленного роста клеток, что приводит к меньшему количеству полипов толстой кишки in vivo , а также к меньшему количеству органоидов толстой кишки.Как таковой, ZBP-89, как было показано, индуцирует клеточное старение при сверхэкспрессии в клетках рака легких из-за его способности рекрутировать HDAC на промотор циклин-зависимого ингибитора p16 INK4A [6]. Таким образом, вклад ZBP-89 в фенотип стволовых клеток, вероятно, связан с его способностью рекрутировать HDAC на специфические промоторы, регулирующие экспрессию генов, которые ингибируют клеточный цикл.

Ферментация пищевых углеводов в толстой кишке является исключительной компетенцией комменсальных бактерий, причем бутират является наиболее часто изучаемым из многочисленных SCFAs [18].Бутират выполняет ряд функций, начиная от источника топлива для колоноцитов и заканчивая модуляцией хроматина посредством ингибирования HDAC [26, 27]. Тем не менее, терапия этим SCFA для подавления воспаления и трансформации неоднозначна, возможно, в результате различных клеточных путей, которые он регулирует [28-30]. Более того, клеточная регуляция бутиратом зависит от метаболического и пролиферативного статуса клетки [31-33]. Обычно уровни бутирата самые низкие в дистальном отделе толстой кишки из-за быстрой ферментации пищевых волокон и использования в качестве основного источника углерода колоноцитами в проксимальном отделе толстой кишки.Это, в свою очередь, коррелирует со склонностью колоректальных опухолей к развитию в дистальном отделе толстой кишки, где уровень бутирата самый низкий [18, 32]. Действительно, несколько полипов, которые развились у мышей, несущих аллели удаленных Zfp148 , находились в дистальном отделе толстой кишки. Кроме того, уровни бутирата в основании крипты толстой кишки, где находятся стволовые клетки, по оценкам, находятся в микромолярном диапазоне, значительно ниже, чем миллимолярные уровни на просветной поверхности [32]. Следовательно, мы обнаружили, что обработка нормальных органоидов толстой кишки миллимолярными количествами бутирата вызывает старение и последующий апоптоз.Однако органоиды из толстой кишки, удаленной с Apc , в которой передача сигналов Wnt повышена, защищали от апоптоза, опосредованного бутиратом, и наблюдали пролиферацию. Напротив, делеция Zfp148 отменяет защитный эффект делеции Apc . Как и бутират, Zimberlin et al. показали, что кишечная делеция как HDAC1, так и HDAC2 in vivo или химическая абляция с помощью специфичного для класса I ингибитора HDAC MS-275 снижают пролиферацию, экспрессию маркеров стволовых клеток и снижают клоногенную способность кишечных органоидов [34].Таким образом, HDAC являются важным фактором поддержания стволовых клеток и частично объясняют, как ZBP-89 вносит вклад в фенотип стволовых клеток в толстой кишке. Мы пришли к выводу, что как в тонком, так и в толстом кишечнике ZBP-89 вносит вклад в поддержание стволовых клеток в качестве модулятора пути Wnt, но также за счет рекрутирования HDAC. Однако кишечные органоиды были более чувствительны к стареющим и апоптотическим эффектам бутирата, чем органоиды, полученные из толстой кишки. Таким образом, в толстой кишке, где присутствует градиент бутирата в зависимости от микробиоты, мы могли бы предсказать, что комплекс ZBP-89-HDAC будет ингибировать CDKN2A и блокировать ингибирование роста в зависимости от воздействия этого мощного природного Ингибитор HDAC.

Таким образом, ZBP-89 играет важную роль в поддержании стволовости как в кишечнике, так и в толстой кишке. Как известный медиатор бутират-зависимой регуляции в клеточных линиях [2, 4], похоже, что способность ZBP-89 взаимодействовать с HDAC способствует его способности взаимодействовать с β-катенином, чтобы противостоять стареющим эффектам бутирата в Мутантные стволовые клетки Apc с высокими уровнями передачи сигналов Wnt и белка β-катенина. Интересно, что, по-видимому, существуют тканеспецифические различия в способности тонкой кишки и толстой кишки противостоять старению, вызванному бутиратом.Взятые вместе, эти результаты дают по крайней мере частичное объяснение того, почему экспрессия белка ZBP-89 способствует образованию аденом толстой кишки и прогрессированию на ранних стадиях рака толстой кишки [9, 35].

МАТЕРИАЛЫ И МЕТОДЫ

Животные модели

Генерация мышей Zfp148 FL / FL на генетическом фоне C57BL / 6 была описана ранее [8]. Apc FL / + , Zfp148 FL / + и Zfp148 FL / FL мышей были скрещены с линией мышей Cdx2Cre [14] или VillinCre [36] для получения гетерозиготных мышей. только для аллеля Apc или с генотипами Zfp148 FL / + и Zfp148 FL / FL ( Cdx2Cre : Apc FL / + : Zfp148 FL / + : Zfp148 FL / + или VillinCre: Apc FL / + : Zfp148 FL / FL [9]).Для создания трансгена Zfp148CreER T2 , кассета кДНК CreER T2 _IRES_eGFP была вставлена ​​ниже ATG мыши Zfp148 ATG в экзоне 4, полученном из клона BAC RP23 2502b14 9068 kb14, который содержит 9068 kb14 клона RP23-207B1. ген мыши (JrGang Cheng, Университет Северной Каролины). Очищенный трансген Zfp148CreER T2 микроинъектировали в пронуклеусы оплодотворенных яиц химерных мышей C57BL / 6 x SJL (University of Michigan Transgenic Core).Три линии-основатели (725, 730 и 740) были скрещены с репортерными мышами Rosa26-LoxSTOPLox-tdTomato ( Rosa-tdT ) (B6.Cg- Gt (ROSA) 26Sor tm27.1 (CAG -COP4 * h234R / tdTomatoHze / J, штамм 012567), приобретенный в лаборатории Джексона. Линии в конечном итоге были скрещены с мышами C57BL / 6 в течение двух лет. Была выбрана самая высокая экспрессия флуоресцентного репортера (линия 730).Мышей содержали в Комитете по уходу и использованию животных Мичиганского университета, который поддерживает Американскую ассоциацию оценки и аккредитации учреждения по уходу за лабораторными животными и одобрил все используемые методы и процедуры.

Иммуногистохимия

Иммуногистохимия выполнялась с использованием метода окрашивания на основе диаминобензидина (DAB) (Abcam, ab4238). После депарафинизации и регидратации извлечение антигена выполняли путем кипячения срезов ткани в микроволновой печи в течение 10 минут с 10 мМ натрийцитратным буфером (pH 6.0). Срезы тканей предварительно инкубировали с 0,3% перекисью водорода, и неспецифические сайты связывания блокировали 20% нормальной козьей сывороткой (Jackson ImmunoResearch, West Grove, PA). Поликлональные антитела к консервативным С-концевым остаткам (611-794) ZBP-89 (1: 1000, sc-48811; Santa Cruz Biotechnology Inc., Санта-Крус, Калифорния) инкубировали в течение 2 часов в увлажненной камере, а затем инкубировали. с пероксидазой хрена (HRP) — вторичным антителом, конъюгированным в течение 30 мин. Срезы окрашивали DAB и контрастировали гематоксилином Майера перед нанесением в Toluene Permount (Fisher Scientific, Waltham, MA).

Гибридизация in situ

Ткань была встроена в O.C.T. Соединение (Tissue –Tek), нарезанное на срезы, помещенное на предметные стекла и затем повторно гидратированное в воде, обработанной DEPC, перед 1-часовой инкубацией перед гибридизацией в 50% растворе формамида / Денхардта при 55 ° C. Одноцепочечные ДНК-зонды (оцДНК), меченные на 5’-конце 6-FAM, восстанавливали в стерильной воде, свободной от РНКаз, разбавляли до рабочей концентрации 50 нг / мл гибридизационным буфером и инкубировали в течение 48 часов при 60 ° C.Предметные стекла тщательно промывали 50% формамидом в 5-кратном солевом растворе цитрата натрия (SSC, pH 7,0) в течение 2 минут при 40 ° C. Образцы промывали водой, обработанной DEPC, и давали им высохнуть на воздухе перед закреплением с помощью реагента Prolong Gold Antifade с DAPI (ThermoFisher; Scientific). Были использованы следующие зонды:

Zfp148 антисмысловой зонд 1: 5’6-FAM / ACCGACT ATTAGTCCAAAGTGGGACTT /

Zfp148 смысловой зонд : 5’6-FAM / TGGCTGATAA последовательность TCAGTGTAAC TCAGGTAAC последовательность TCAGGTAAC

TCAGGTTTAC последовательность

TCAGGTAAC

TCAGGTAAC

TCAGGTAAC последовательность

использовали в качестве отрицательного контроля.

Образование органоидов мыши

Слизистую оболочку кишечника или толстой кишки измельчали ​​на кусочки 5 мм на льду с последующей диссоциацией железы в 2 мМ EDTA / PBS при 4 ° C в течение 30 минут для ткани кишечника и 4 мМ EDTA / PBS при 4 ° C в течение 60 минут для ткани толстой кишки . После фильтрации через фильтр для клеток 70 мкм (BD Bioscience) для кишечника и фильтр для клеток 100 мкм (BD Bioscience) для толстой кишки суспензию центрифугировали при 200 × g в течение 5 минут. Кишечные железы ресуспендировали в 50 мкл матригеля с добавлением Advanced DMEM / F12 (Invitrogen), содержащего 50% кондиционированной среды Wnt, R-Spondin, Noggin, полученной из L-WRN (линия клеток ATCC® CRL-3276 ™) с B27. и добавки N2 1X (ThermoFisher; Scientific) плюс EGF (50 нг / мл, Invitrogen).Для создания органоидов толстой кишки среду смешивали с матригелем, содержащим CHIR99021 (10 мМ, STEMCELL), Y-27632 (10 мМ, STEMCELL), A83-01 (500 нМ, Sigma-Aldrich) и гастрин (10 нМ, Sigma-Aldrich). Препараты органоидов культивировали при 37 ° C в 5% CO 2 . Обработка бутиратом органоидов кишечника или толстой кишки проводилась через 3 дня после того, как органоиды закрепились в среде Advanced DMEM / F12. По получении были созданы замороженные запасы клеток L-WRN, которые проверялись на микоплазму каждые 3 месяца.Окрашивание органоидов толстой кишки EdU проводили в течение 16 часов с использованием набора Click-iT® EdU Imaging Kit и разработали в соответствии с инструкциями производителя. Включение EdU количественно оценивали с помощью программы Cellprofiler (http://cellprofiler.org/), сравнивая площадь EdU с ядрами, окрашенными DAPI, на изображение [37]. Были проанализированы пять изображений органоидов, полученных от 3 мышей на каждый генотип на каждое состояние за один пассаж.

In vitro Индукция тамоксифена

Для активации трансгена CreERT2 в культуре органоиды инкубировали с низкой дозой 4-гидрокситамоксифена (4-OH-Tx, 100 нМ) в течение 24 часов в полном Advanced DMEM / F12 (Invitrogen).После инкубации культуры промывали PBS, а затем добавляли свежую полную среду.

Количественная ПЦР в реальном времени

Суммарная РНК из кишечника и толстой кишки была извлечена и очищена с использованием набора PureLink RNA Mini Kit (ThermoFisher). РНК (1 мкг) обрабатывали ДНКазой (Promega) и использовали для создания кДНК с использованием набора для обратной транскриптазы iScript (Bio-Rad, Hercules, CA). Количественную полимеразную цепную реакцию в реальном времени (RT-qPCR) проводили с использованием ДНК-полимеразы Platinum Taq (Invitrogen) в системе обнаружения ПЦР в реальном времени CFX96 (Bio-RAD), используя следующие последовательности праймеров (Tm = 65 ° C для всех праймеры):

Zfp148 : F: 5 ‘TCCAAACCACTGATTCTTCTCTT; R: 5 ’AGTTCTCTCCCCTCCCCCT

Lgr5 : F: 5’ TCTTCTAGGAAGCAGAGGCG; R: 5 ’CAACCTCAGCGTCTTCACCT

Cdkn2: F: GCAGAAGAGCTGCTACGTGA; R: 5 ’CGTGAACATGTTGTTGAGGC

Cdx2 : F: 5’ TCTGTGTACACCACCCGGTA; R: 5 ’GAAACCTGTGCGAGTGGATG

Reg4 : F: 5’ GCACAGCTGGGTCTCAAGAT; R: 5 ’CATCGAAAGAGGAAGATGGC

Axin2 : F: 5’ TGCATCTCTCTCTGGAGCTG; R: 5 ’ACTGACCGACGATTCCATGT

Notch2 : F: 5’ CTGAGGCAAGGATTGGAGTC; R: 5 ’GAATGGAGGTAGGTGCGAAG

Ctnnb1 : F: 5’ CAGCTTGAGTAGCCATTGTCC; R: 5 ’GAGCCGTCAGTGCAGGAG.

Проточная цитометрия и сортировка клеток

Изолированные крипты инкубировали в культуральной среде в течение 45 минут при 37 ° C с последующей диссоциацией клеток с использованием Accutase (STEMCELL) в течение 15 минут при 37 ° C. Диссоциированные клетки фильтровали через фильтр для клеток с размером пор 40 мкм (BD Bioscience). TdTomato -положительные клетки сортировали методом проточной цитометрии с использованием сортировщика iCyt Synergy Flow (Sony Biotechnology). Единичные жизнеспособные эпителиальные клетки как из кишечника, так и из толстой кишки были заблокированы прямым рассеянием, боковым рассеянием, параметром ширины импульса и отрицательным окрашиванием на DAPI (Sigma Aldrich).Отсортированные клетки собирали в культуральную среду крипт, заливали матригелем и затем покрывали полной культуральной средой.

TUNEL assay

Трехдневные органоиды тонкой кишки или толстой кишки ресуспендировали при диссоциации холодных клеток с 2 мМ ЭДТА / PBS и инкубировали при 4 ° C в течение 10 минут, а затем фильтровали через фильтр для клеток 40 мкм (BD Bioscience). Суспензию центрифугировали при 200 × г в течение 5 минут, осаждали и затем ресуспендировали в 1 мл 3,7% формальдегида. После инкубации в течение 10 минут фиксированные клетки промывали холодным PBS и метили с использованием набора флуоресцеина TACS 2 TdT в соответствии с процедурой производителя (Trevigen, MD).Общее количество TdT-положительных клеток для каждой популяции рассчитывали, используя процент стробирования, умноженный на общее количество клеток, меченных DAPI (Sigma Aldrich). Анализ выполняли с использованием программного обеспечения FlowJo (TreeStar, Ashland OR).

Анализ активности галактозидазы, связанной со старением

Активность галактозидазы определяли количественно в органоидах кишечника и толстой кишки с использованием набора для гистохимического окрашивания Senescence Cells (Sigma Aldrich) в соответствии с инструкциями производителя.Окрашивание проявлялось в течение 10 часов и визуализировалось в инвертированном оптическом микроскопе (Leica). Для количественного анализа органоиды кишечника или толстой кишки лизировали в буфере RIPA (ThermoFisher) в течение 10 минут и центрифугировали при 10000 × g в течение 5 минут, супернатант собирали и оптическую плотность измеряли на планшет-ридере на A 460.

Хроматин иммунопреципитация (ChIP)

Клетки SW480 обрабатывали 1% формальдегидом, а затем гасили глицином в течение 5 минут при комнатной температуре.Лизаты клеток обрабатывали ультразвуком для разделения ДНК на фрагменты размером от 200 до 1000 пар оснований (8 циклов с 30-секундными интервалами) с использованием 130W Sonic Vibracell (VCX130PB). Аликвоту (5%) лизатов удаляли и использовали в качестве ввода, а оставшийся раствор использовали для иммунопреципитации сшитого белка с использованием моноклонального антитела ZBP-89 и антитела IgG в качестве контроля. Иммунные комплексы улавливали с использованием бусинок агарозы с протеином A / G, после промывки связанные белки элюировали с бус и разбавляли 1:15 в деионизированной воде (набор EZ Magna ChIP A / G, Millipore).После переваривания протеиназой К и РНКазой А очищенную ДНК анализировали с помощью ПЦР с использованием ДНК-полимеразы NovaTap (Millipore) с использованием фланкирующих промоторных праймеров для CDKN2A и праймеров для хромогранина А (ChrA), гена, не регулируемого ZBP-89. Значения ChIP-qPCR выражали в процентах от введенной ДНК.

ChIP-seq

Мышиные клетки STC-1 обрабатывали 2,5 мМ бутирата в течение 6 часов перед добавлением 1% формальдегида. После выполнения иммунопреципитации хроматина (ChIP) с антителом ZBP-89 (Санта-Крус, Калифорния) было выполнено создание библиотеки и секвенирование Illumina с помощью UM Sequencing Core.Преобразование последовательностей в Fastq выполняли с использованием программного обеспечения CASAVA-1.8.2 компании Illumina. Оценки Q были определены с использованием ASCII + 33. Геномные сигнатуры анализировали для GC-богатых консенсусных сайтов ZBP-89 в пределах 1kb от сайтов начала транскрипции (TSS). Повторяющиеся чтения секвенирования для каждой обработки были сопоставлены с мышью GRC m38 / mm10, а файлы BAM были преобразованы в BigWig для анализа в браузере генома UCSC.

Статистический анализ

Двухфакторный дисперсионный анализ ANOVA с тестом множественных сравнений Тьюки выполняли для анализа количества органоидов и анализов пролиферации клеток.Односторонний дисперсионный анализ с тестом множественных сравнений Краскела-Уоллиса использовался для сравнения количества полипов на один генотип. Двусторонний дисперсионный анализ с тестом множественных сравнений Сидака использовался для сравнения размера органоидов на каждый генотип в зависимости от состояния.

Вклад авторов

Концепция и дизайн: Р. Окадис-Руис, Дж. Л. Мерчант. Разработка методологии: Р. Окадис-Руис, А. Фотенгауэр, Л. Динг, Дж. Л. Мерчант. Сбор данных (предоставленные животные, оборудование и т. Д.): Р. Окадис-Руис, А.Photenhauer, M. Hayes, E. Fearon, L. Ding, J.L. Merchant. Написание, рецензирование и редактирование рукописи: Р. Окадис-Руис, Дж. Л. Мерчант. Научное руководство: Р. Окадис-Руис, J.L. Merchant.

БЛАГОДАРНОСТЬ И ФИНАНСИРОВАНИЕ

Авторы выражают признательность за поддержку со стороны грантов службы общественного здравоохранения: R01 DK55732; Онкологический центр UM P30 CA046592; UM Центр болезней органов пищеварения 5P30 DK034933.

КОНФЛИКТ ИНТЕРЕСОВ

Ни один из авторов не имеет конфликта интересов.

СПРАВОЧНАЯ ИНФОРМАЦИЯ

1.Merchant JL, Iyer GR, Taylor BR, Kitchen JR, Mortensen ER, Wang Z, Flintoft RJ, Michel JB, Bassel-Duby R. ZBP-89, подобный Круппелю белок цинковых пальцев, подавляет индукцию эпидермального фактора роста промотора гастрина. . Mol Cell Biol. 1996; 16: 6644-53.

2. Бай Л., Торговец JL. Фактор транскрипции ZBP-89 взаимодействует с гистонацетилтрансферазой p300 во время бутиратной активации транскрипции p21waf1 в клетках человека. J Biol Chem. 2000; 275: 30725-33. https://doi.org/10.1074/jbc.M004249200.

3. Бай Л., Торговец JL. ZBP-89 способствует остановке роста за счет стабилизации p53. Mol Cell Biol. 2001; 21: 4670-83. https://doi.org/10.1128/MCB.21.14.4670-4683.2001.

4. Бай Л., Као Дж.Й., ди-джей закона, торговец Дж. Л. Рекрутинг атаксии-телеангиэктазии, мутированной в промотор p21 (waf1) с помощью ZBP-89, играет роль в защите слизистой оболочки. Гастроэнтерология. 2006; 131: 841-52. https://doi.org/10.1053/j.gastro.2006.06.014.

5. Вечорек Э., Лин З., Перкинс Э. Б., ди-джей по праву, торговец JL, Зенер З.Репрессор цинкового пальца, ZBP-89, связывается с сайлент-звеном гена виментина человека и образует комплексы с активатором транскрипции Sp1. J Biol Chem. 2000; 275: 12879-88.

6. Фен И, Ван Х, Сюй Л., Пан Х, Чжу С., Лян К., Хуанг Б., Лу Дж. Фактор транскрипции ZBP-89 подавляет экспрессию p16 через механизм модификации гистонов, чтобы влиять на старение клеток. FEBS J. 2009; 276: 4197-206. https://doi.org/10.1111/j.1742-4658.2009.07128.x.

7. Wu Y, Zhang X, Salmon M, Zehner ZE.Репрессор цинкового пальца, ZBP-89, рекрутирует гистоновую деацетилазу 1 для подавления экспрессии гена виментина. Гены Клетки. 2007; 12: 905-18. https://doi.org/10.1111/j.1365-2443.2007.01104.x.

8. Эссьен Б.Е., Грасбергер Х., Ромен Р.Д., Ло Д.Д., Вениаминова Н.А., Саки-Сальсес М., Эль-Заатари М., Тессье А., Хейс М.М., Янг А.С., Торговец Дж.Л. ZBP-89 регулирует экспрессию триптофангидроксилазы I и защиту слизистой оболочки от Salmonella Typhimurium у мышей. Гастроэнтерология. 2013; 144: 1466-77. https://doi.org/10.1053 / j.gastro.2013.01.057.

9. Эссьен Б.Э., Сундаресан С., Окадис-Руис Р., Чавис А., Цао А.С., Тессье А.Дж., Хейс М.М., Фотенхауэр А., Саки-Сальсес М., Канг А.Дж., Шах Ю.М., Дьерфи Б., Мерчант Дж.Л. Фактор транскрипции ZBP-89 управляет прямой петлей экспрессии бета-катенина при колоректальном раке. Cancer Res. 2016; 76: 6877-87. https://doi.org/10.1158/0008-5472.CAN-15-3150.

10. Закон Г.Л., Ито Х., Закон Д.Д., Мизе Г.Дж., Торговец Д.Л., Моррис Д.Р. Фактор транскрипции ZBP-89 регулирует активность промотора орнитиндекарбоксилазы.J Biol Chem. 1998; 273: 19955-64.

11. Ли X, Ромен Р. Д., Парк Д., Скадден Д. Т., Торговец Дж. Л., Арнаут, Массачусетс. Стресс-гемопоэз регулируется транскрипционным фактором ZBP-89, подобным Круппелу. Стволовые клетки. 2014; 32: 791-801. https://doi.org/10.1002/stem.1598.

12. Баркер Н., ван Эс Дж., Койперс Дж., Куяла П., ван ден Борн М., Козейнсен М., Хегебарт А., Корвинг Дж., Бегтель Х., Петерс П. Дж., Клеверс Х. Идентификация стволовых клеток в тонком и толстом кишечнике с помощью маркерный ген Lgr5. Природа. 2007; 449: 1003-7.https://doi.org/10.1038/nature06196.

13. Leushacke M, Tan SH, Wong A, Swathi Y, Hajamohideen A, Tan LT, Goh J, Wong E, Denil S, Murakami K, Barker N. Главные клетки, экспрессирующие Lgr5, управляют регенерацией эпителия и раком в оксинтике. желудок. Nat Cell Biol. 2017; 19: 774-86. https://doi.org/10.1038/ncb3541.

14. Хинои Т., Акьол А., Тайзен Б.К., Фергюсон Д.О., Гринсон Дж. К., Уильямс Б.О., Чо К.Р., Fearon ER. Мышиная модель прогрессирования аденомы-карциномы толстой кишки на основе соматической инактивации Apc.Cancer Res. 2007; 67: 9721-30. https://doi.org/10.1158/0008-5472.can-07-2735.

15. Сасаки Н., Сакс Н., Вибрандс К., Элленбрук С.И., Фумагалли А., Любимова А., Бегтель Х., ван ден Борн М., ван Эс Дж. Х., Картхаус В. Р., Ли В. С., Лопес-Иглесиас К., Петерс П. Дж. И др. . Секреторные клетки глубоких крипт Reg4 + функционируют как эпителиальная ниша для Lgr5 + стволовых клеток в толстой кишке. Proc Natl Acad Sci U S. A. 2016; 113: E5399-407. https://doi.org/10.1073/pnas.1607327113.

16. Verzi MP, Shin H, He HH, Sulahian R, Meyer CA, Montgomery RK, Fleet JC, Brown M, Liu XS, Shivdasani RA.Специфичные для дифференцировки модификации гистонов выявляют динамические взаимодействия хроматина и партнеров для кишечного транскрипционного фактора CDX2. Dev Cell. 2010; 19: 713-26. https://doi.org/10.1016/j.devcel.2010.10.006.

17. Кавасаки Ю., Мацумура К., Миямото М., Цудзи С., Окуно М., Суда С., Хиёси М., Китайма Дж., Акияма Т. REG4 является транскрипционной мишенью GATA6 и необходим для колоректального онкогенеза. Sci Rep.2015; 5: 14291. https://doi.org/10.1038/srep14291.

18. Топпинг Д.Л., Клифтон П.М.Короткоцепочечные жирные кислоты и функция толстой кишки человека: роль резистентных крахмальных и некрахмальных полисахаридов. Physiol Rev.2001; 81: 1031-64.

19. Вербеке К.А., Бубис А.Р., Чиодини А., Эдвардс К.А., Франк А., Клеребезем М., Наута А., Раес Дж., Ван Тол Е.А., Туохи К.М. К метаболитам микробной ферментации как маркерам пользы пребиотиков для здоровья. Nutr Res Rev.2015; 28: 42-66. https://doi.org/10.1017/S0954422415000037.

20. Леонтьева О.В., Благосклонный М.В. Препараты, ингибирующие CDK4 / 6, заменяют р21 и р16 при старении: продолжительность остановки клеточного цикла и активность MTOR определяют героконверсию.Клеточный цикл. 2013; 12: 3063-9. https://doi.org/10.4161/cc.26130.

21. Доу Л.Е., О’Рурк К.П., Саймон Дж., Чахарганех Д.Ф., ван Эс Дж. Х., Клеверс Х., Лоу SW. Восстановление Apc способствует дифференцировке клеток и восстанавливает гомеостаз крипт при колоректальном раке. Клетка. 2015; 161: 1539-52. https://doi.org/10.1016/j.cell.2015.05.033.

22. Мэтью О.П., Ранганна К., Ятсу FM. Бутират, ингибитор HDAC, стимулирует взаимодействие между различными посттрансляционными модификациями гистона h4 и по-разному изменяет G1-специфические белки клеточного цикла в гладкомышечных клетках сосудов.Biomed Pharmacother. 2010; 64: 733-40. https://doi.org/10.1016/j.biopha.2010.09.017.

23. Лоренц В., Хессенкемпер В., Родигер Дж., Кириленко С., Крафт Ф., Баниахмад А. Бутират натрия вызывает клеточное старение в клетках нейробластомы и рака простаты. Horm Mol Biol Clin Investig. 2011; 7: 265-72. https://doi.org/10.1515/HMBCI.2011.020.

24. Варгас Дж. Э., Филиппи-Чила ЕС, Сухре Т., Киппер Ф. К., Бонатто Д., Ленц Г. Ингибирование HDAC увеличивает старение, вызванное естественными полифенолами в клетках глиомы.Biochem Cell Biol. 2014; 92: 297-304. https://doi.org/10.1139/bcb-2014-0022.

25. Нилтон А., Сайин В.И., Зоу З.В., Саин С.И., Бонджерс С., Гул Н., Агрен П., Фогельстранд П., Нильссон О., Берго М.О., Линдал П. Нацеливание на Zfp148 активирует p53 и снижает инициацию опухоли в кишечнике. Oncotarget. 2016; 7: 56183-92. https://doi.org/10.18632/oncotarget.10899.

26. Пуэртоллано Э., Колида С., Якуб П. Биологическое значение метаболизма короткоцепочечных жирных кислот кишечным микробиомом. Curr Opin Clin Nutr Metab Care.2014; 17: 139-44. https://doi.org/10.1097/MCO.0000000000000025.

27. Вальдекер М., Каутенбургер Т., Дауманн Х., Буш С., Шренк Д. Ингибирование активности гистон-деацетилазы короткоцепочечными жирными кислотами и некоторыми метаболитами полифенолов, образующимися в толстой кишке. J Nutr Biochem. 2008; 19: 587-93. https://doi.org/10.1016/j.jnutbio.2007.08.002.

28. Lupton JR. Продукты микробной деградации влияют на риск рака толстой кишки: спор о бутирате. J Nutr. 2004; 134: 479-82.

29.Бордонаро М, Лазарова Д.Л., Сарторелли АС. Сигнализация бутирата и Wnt: возможное решение загадки пищевых волокон и риска рака толстой кишки? Клеточный цикл. 2008; 7: 1178-83.

30. Hamer HM, Jonkers D, Venema K, Vanhoutvin S, Troost FJ, Brummer RJ. Обзорная статья: роль бутирата в функции толстой кишки. Алимент Pharmacol Ther. 2008; 27: 104-19. https://doi.org/10.1111/j.1365-2036.2007.03562.x.

31. Донохо Д.Р., Гарге Н., Чжан Х, Сан В., О’Коннелл TM, Бангер М.К., Бултман С.Дж. Микробиом и бутират регулируют энергетический обмен и аутофагию в толстой кишке млекопитающих.Cell Metab. 2011; 13: 517-26. https://doi.org/10.1016/j.cmet.2011.02.018.

32. Донохо Д. Р., Коллинз Л. Б., Вали А., Биглер Р., Сан В., Бултман С. Дж. Эффект Варбурга определяет механизм опосредованного бутиратом ацетилирования гистонов и пролиферации клеток. Mol Cell. 2012; 48: 612-26. https://doi.org/10.1016/j.molcel.2012.08.033.

33. Донохо Д.Р., Вали А., Брылавски Б.П., Бультман С.Дж. Микробная регуляция метаболизма глюкозы и прогрессирования клеточного цикла в колоноцитах млекопитающих. PLoS One.2012; 7: e46589. https://doi.org/10.1371/journal.pone.0046589.

34. Цимберлин С.Д., Ланчини С., Сно Р., Розекранс С.Л., Маклин С.М., Вламинг Х., ван ден Бринк Г.Р., Боты М., Медема Дж. П., Данненберг Дж. Х. HDAC1 и HDAC2 совместно регулируют гомеостаз кишечных стволовых клеток. FASEB J. 2015; 29: 2070-80. https://doi.org/10.1096/fj.14-257931.

35. Гао XH, Лю QZ, Chang W, Xu XD, Du Y, Han Y, Liu Y, Yu ZQ, Zuo ZG, Xing JJ, Cao G, Fu CG. Экспрессия ZNF148 на разных стадиях развития колоректального рака и ее прогностическое значение: большое китайское исследование, основанное на тканевых микроматрицах.Рак. 2013; 119: 2212-22. https://doi.org/10.1002/cncr.28052.

36. Мэдисон ББ, Данбар Л., Цяо XT, Браунштейн К., Браунштейн Э, Гумусио Д.Л. Цис-элементы гена виллина контролируют экспрессию в ограниченных доменах вертикальной (крипта) и горизонтальной (двенадцатиперстная кишка, слепая кишка) осей кишечника. J Biol Chem. 2002; 277: 33275-83. https://doi.org/10.1074/jbc.M204935200.

37. Каменцкий Л., Джонс Т. Р., Фрейзер А., Брей М. А., Логан Д. Д., Мэдден К. Л., Лйоса В., Рюден С., Элисейри К. В., Карпентер А. Е..Улучшенная структура, функции и совместимость с CellProfiler: модульным программным обеспечением для анализа изображений с высокой пропускной способностью. Биоинформатика. 2011; 27: 1179-80. https://doi.org/10.1093/bioinformatics/btr095.

Премиум GPTTNN9013AA36AA — Go Powertrain LLC

Общая информация
• Стоимость доставки, включая возврат основного капитала.
• Базовая стоимость не включена.

• Трансмиссия включает гидротрансформатор и синтетическую трансмиссионную жидкость.
• Все трансмиссии полностью разобраны и очищены.
• Все корпуса прошли струйную очистку.
• Внутренние детали проверяются на наличие износа или повреждений и при необходимости заменяются.
• Все втулки проверяются и при необходимости заменяются.
• 100% фрикционных деталей заменены на модернизированные детали повышенной прочности.
• Барабаны проверяются на воздух и боковой люфт проверяется для обеспечения надлежащего зазора.
• Заменено 100% уплотнений, уплотнительных колец и прокладок.
• 100% соленоидов проверяются и заменяются, если они не проходят испытания рабочего цикла.
• Внутренний жгут проводов проверяется и при необходимости заменяется.
• Корпуса клапанов разбираются, очищаются и измеряются на предмет износа.
• Клапаны корпуса клапана и отверстия клапана проверяются, а отверстия клапана обрабатываются по мере необходимости.
• Готовые корпуса клапана проверяются на правильность работы перед динамометрическими испытаниями.
• Коробки передач собраны, люфты установлены, крепежные детали затянуты до требуемой спецификации.
• 100% трансмиссий проходят динамометрические испытания, чтобы гарантировать надлежащее давление и качество переключения передач во всем рабочем диапазоне.
• Все переключения на повышенную и понижающую передачи проверяются по предустановленным параметрам.
• Скорость остановки и блокировка гидротрансформатора проверяются на динамометрическом тесте.
• Механизм блокировки парковки трансмиссии проверяется во время динамометрического теста.
Базовая гарантия на этот продукт включает в себя:

• Цена включает базовую гарантию на 36 месяцев без ограничений по всей стране, которая покрывает сборку и работы по демонтажу и повторной установке из расчета 70 долларов за час работы.
• Также включает 200 долларов США на буксировку И / ИЛИ возмещение расходов на аренду автомобиля по утвержденной заявке на оплату труда.
• Ядро необходимо вернуть или приобрести, чтобы активировать гарантию.
• См. Экран оформления заказа для получения информации о возможных расширениях гарантии.

Заведения по почтовому индексу | Тип бизнеса


Характеристика учреждения бизнеса по почтовому индексу
— ресурсы данных и аналитика данных

Май 2020 .. влияние пандемии на бизнес остается в постоянном движении. В этом разделе рассматривается подготовка к пандемии бизнес-учреждения и модели занятости и характеристики по почтовому индексу.Изучая предпандемические условия, мы можем лучше оценивать влияние того, как и почему бизнес, демографические и экономические изменения и влияние по мере нашего продвижения вперед. Величина и продолжительность воздействия на бизнес будет зависеть от сообщества / района и станут более измеримыми в ближайшие месяцы. Информация о том, как и где организовывать бизнес / изменение занятости, будет обновлена ​​позже в 2020 году. Подробнее об этих данных.

Используйте инструменты, описанные в этом разделе, для анализа шаблонов и характеристик бизнес-шаблонов почтовых индексов.В интерактивной таблице представлены данные о характеристиках бизнес-заведений за 2016 и 2017 годы по Почтовый индекс. Используйте инструменты ГИС и связанный проект ГИС для разработки вариантов представлений, показанных ниже.

См. Также:
• Графические бизнес-модели
• Почтовые индексы с наибольшим количеством заведений. См. Ниже
• Связанные ресурсы данных. См. Ниже

Образцы производственных предприятий по почтовому индексу
На следующем рисунке показаны схемы количества производственных предприятий по почтовым индексам.Легенда на вставке показывает образец цвета / процента. Щелкните изображение, чтобы увеличить его. Более крупный вид включает вид на уровне графства. Разверните окно браузера для просмотра в наилучшем качестве. Используйте инструменты CV XE GIS и базу данных бизнес-шаблонов ZIP для создания подобных представлений для любого типа бизнеса. (детализация до 6-ти значного уровня НАИКС). Изучите количество заведений по размеру занятости.

— просмотр, разработанный с использованием ProximityOne CV XE GIS и соответствующего проекта ГИС.

Увеличенный вид на метро и регион Атланты
На следующем рисунке показаны модели количества производственных предприятий по почтовым индексам. для Атланты, Джорджия. Метро выделено жирной коричневой границей. Легенда на вставке показывает образец цвета / процента. Округа показаны черной границей. Щелкните изображение, чтобы увеличить его. На большем экране показаны почтовые индексы, помеченные значком количество производственных предприятий в процентах от общего числа предприятий по почтовым индексам.Разверните окно браузера для просмотра в наилучшем качестве. Используйте инструменты CV XE GIS и базу данных бизнес-шаблонов ZIP для создания представлений, интегрированных с вашими собственными данными и другими географическими данными, такими как точечные местоположения. Изучите любой вид бизнеса (детализация до 6-ти значного уровня НАИКС). Изучите количество заведений по размеру занятости.

— просмотр, разработанный с использованием ProximityOne CV XE GIS и соответствующего проекта ГИС.

Почтовый индекс Бизнес-шаблоны Интерактивный стол
См. Примечания по использованию под таблицей ранжирования.См. Соответствующие интерактивные таблицы.

Примечания по использованию
• Щелкните заголовок столбца для сортировки по этому столбцу; щелкните заголовок столбца еще раз, чтобы выполнить сортировку в другом направлении.
• Нажмите кнопку «Показать все», чтобы отобразить все области и восстановить полный набор данных.
• Щелкните Состояние, чтобы просмотреть ZIP-файлы в выбранном состоянии (между выборками щелкните Показать все).
• Поиск по имени: введите частичное имя области в текстовом поле справа от кнопки «Найти по имени»
затем нажмите кнопку, чтобы найти все совпадения (с учетом регистра).
• См. Соответствующие интерактивные таблицы.

Описание заголовков столбцов
— ZIP
— Город
— Округ
— ул.
— Учреждения — 2016
— Учреждений — 2017
— Заведения — 2016-2017 смена
— Учреждения — 2016-2017 процентное изменение
— Занятость — середина марта 2016 г.
— Трудоустройство — середина марта 2017 года
— Занятость — 2016-2017 смена
— Занятость — 2016-2017 гг. Изменение в процентах
— Заработная плата за 1 квартал — 2016 г. ($ 000)
— Заработная плата за 1 квартал — 2017 г. ($ 000)
— Заработная плата за 1 квартал — изменение 2016-2017 гг. ($ 000)
— Фонд заработной платы за 1 квартал — 2016-2017 гг., Процентное изменение
— Годовой фонд заработной платы — 2016 г. ($ 000)
— Годовой фонд заработной платы — 2017 г. ($ 000)
— Годовой фонд заработной платы — изменение 2016-2017 гг. ($ 000)
— Годовой фонд заработной платы — изменение в процентах 2016-2017 гг.

Сравнить выбранные ZIP-файлы
Найдите интересующий ZIP-архив.Щелкните строку правой кнопкой мыши; он становится синим; выберите Копировать в раскрывающемся списке; строка копируется в буфер обмена. Откройте Excel или другой другой инструмент. Вставить буфер обмена в строку / ячейку. Повторите этот процесс для дополнительных почтовых индексов. Укажите источник любого использования этих данных: ProximityOne и Бюро переписи населения. и добавьте ссылку на эту страницу: http://proximityone.com/zipbusiness.htm.

Более подробные данные по почтовому индексу — вид деятельности
Более подробные характеристики предприятий доступны по почтовому индексу, а краткое изложение: Код НАИКС.

991 99189 91 871 N1000
Почтовый индекс Почтовый индекс
NAICS Отраслевой код — 6-значный код NAICS.
EST Общее количество заведений
N1_4 Количество заведений: Класс размера занятости: 1-4 сотрудника
N5_9 Количество сотрудников Класса размера занятости: 5000
N10_19 Количество заведений: Класс по размеру занятости: 10-19 сотрудников
N20_49 Количество заведений: Класс по размеру занятости: 20-49 сотрудников
N50_99 Количество заведений Класс: 50-99 сотрудников
N100_249 Количество заведений: Размер занятости Класс: 100-249 сотрудников
N250_499 Количество заведений: Размер занятости Класс: 250-499 сотрудников
Количество заведений: Класс по размеру занятости: 500-999 Число сотрудников
Количество заведений: Класс по размеру занятости: 1000 и более сотрудников

Образцы амбулаторных служб здравоохранения по почтовому индексу: Хьюстон, Техас, район метро
На следующем рисунке показаны образцы учреждений амбулаторной медицинской помощи по почтовому индексу в районе метро Хьюстона, штат Техас. (жирная граница).В легенде на вставке показано количество заведений, которые можно раскрасить на карте. Щелкните изображение, чтобы увеличить его, увеличьте изображение округа Харрис. На увеличенном изображении показаны почтовые индексы, помеченные почтовым индексом и номером Учреждения амбулаторных медицинских услуг. (НАИКС 621). Приблизительно 10 000 «621» заведения в округе Харрис разбиваются на 133 почтовых индекса. Как это сочетание / распределение изменится с пандемией?

Почтовые индексы с наибольшим количеством заведений .. перейти наверх
Девять из 10 лучших почтовых индексов оцениваются по количеству заведений, расположенных на Манхэттене (округ Нью-Йорк, штат Нью-Йорк), и насчитывают в общей сложности 51 183 заведения. и 1,2 миллиона сотрудников со среднегодовой заработной платой 117 115 долларов США. Просмотрите этот рейтинг, используя интерактивную таблицу выше. Девять почтовых индексов показаны на рисунке ниже с желтыми этикетками с почтовыми индексами
.
— просмотр, разработанный с использованием ProximityOne CV XE GIS и соответствующего проекта ГИС.

О компании ZIP .. перейти наверх
Деловые заведения — это места работы, которые определяют и определяют экономику. Почтовые индексы — это наименьший географический регион, по которому доступны данные о предприятиях. Данные о бизнес-шаблонах с почтовым индексом могут помочь заинтересованным сторонам определить области занятости, возможности для бизнеса и многое другое. Хотя мы можем получить данные о занятости (по месту жительства) для районов с почтовыми индексами из исследования американского сообщества. 5-летняя оценка (ACS), количество заведений данные о занятости по месту работы доступны только из данных о бизнес-структурах ZIP.

Ежегодно обновляемые коммерческие данные ZIP получены из конфиденциального реестра предприятий, который ведется Бюро переписи населения. В реестре содержится запись о каждом известном заведении в США с сотрудниками. Заведение — это единое физическое место, где ведутся бизнес-операции. имеют место и по которым ведется заработная плата и записи о занятости. В отличие от оценок домохозяйств, основанных на выборке, таких как исследование американского сообщества. 5-летние оценки (ACS), данные бизнес-моделей ZIP основаны на по данным, предоставленным отдельными предприятиями.Бизнес-данные отдельных заведений представлены в почтовом индексе, округе и для географии более высокого уровня.

Объем предмета предоставляется в двух отдельных наборах сводных данных. «Итоговые» данные, использованные выше в этом разделе, предоставляют данные об общем количестве заведений, Заработная плата за первый квартал, занятость и годовая заработная плата. «Подробные» данные содержат сводные данные по заведениям, занятости и заработной плате по отраслям / предприятиям сектор (по кодам НАИКС).

Включено большинство отраслей НАИКС. Растениеводство и животноводство (НАИКС 111,112), железнодорожные перевозки (НАИКС 482), почтовая служба (НАИКС 491), пенсионные, медицинские, социальные и отпускные фонды (НАИКС 525110, 525120, 525190), трасты, поместья и счета агентств (НАИКС 525920), частные домохозяйства (НАИКС 814) и государственное управление (НАИКС 92) исключены. Хотя большинство государственных учреждений исключены, включены следующие: спонсируемые государством предприятия оптовой торговли спиртными напитками (NAICS 4248), розничные магазины спиртных напитков (NAICS 44531), книжные издательства (511130), федеральные сберегательные учреждения (NAICS 522120), федеральные кредитные союзы (NAICS 522130) и больницы (NAICS 622) .

Связанные данные .. перейти наверх
• Демографические данные по почтовому индексу — ACS2018
• Интерактивные демографические таблицы по почтовым индексам (ACS 2016)
• Квартальные учреждения округа, занятость, доходы по НАИКС

Группа пользователей ProximityOne
Присоединяйтесь к группе пользователей ProximityOne чтобы быть в курсе последних событий, касающихся метрополитенов и информационных ресурсов для принятия решений по географии их расположения.Получайте обновления и доступ к инструментам и ресурсам, доступным только участникам. Используйте эту форму, чтобы присоединиться к группе пользователей.

Поддержка с использованием этих ресурсов
Узнайте больше о доступе и использовании демографо-экономических данных и связанных с ними аналитических инструментов. Присоединяйтесь к нам в сессии Data Analytics Lab. За эти часовые сеансы Интернета плата не взимается. Каждая неформальная сессия посвящена определенной теме. Открытая структура также предусматривает вопросы и ответы и обсуждение вопросов приложения, интересующих участников.

Дополнительная информация
ProximityOne разрабатывает геодемографические и экономические данные и аналитические инструменты, а также помогает организациям объединять и использовать различные данные для принятия решений и анализа. Мы разрабатываем индивидуальные демографические / экономические оценки и прогнозы, разрабатываем файлы с географическими и геокодированными адресами, а также помогаем с анализом воздействия и геопространственным анализом. Широкий круг организаций использует наши инструменты (программное обеспечение, данные, методологии) для анализа собственных данных, интегрированных с другими данными.Следите за новостями ProximityOne в Твиттере по адресу www.twitter.com/proximityone. Свяжитесь с нами (888-364-7656) с вопросами о данных, представленных в этом разделе, или для обсуждения индивидуальные оценки, прогнозы или анализы для ваших интересов.

Защитное снаряжение Спортивные товары Новое снаряжение Pro-Tec Z-Cool ZBP Спинка для молодежного футбола d-or-d.com

Защитное снаряжение Спортивные товары New Gear Pro-Tec Z-Cool ZBP Спинка для молодежного футбола d-or-d. ком

Спинка для молодежного футбола New Gear Pro-Tec Z-Cool ZBP, задняя пластина New Gear Pro-Tec Z-Cool ZBP для молодежного футбола. Нажмите здесь, чтобы увидеть описание.Спинка для молодежного футбола New Gear Pro-Tec Z-Cool ZBP.

Спинка для молодежного футбола New Gear Pro-Tec Z-Cool ZBP





New Gear Pro-Tec Z-Cool ZBP Молодежная футбольная задняя пластина

Спинка для молодежного футбола Gear Pro-Tec Z-Cool ZBP, новая 8425656. Нажмите здесь, чтобы увидеть описание ..

Спинка для молодежного футбола New Gear Pro-Tec Z-Cool ZBP

Журнал учета погружений Журнал учета погружений с аквалангом на 60 страниц.Рюкзак для футбола национальной сборной JFA Samurai JAPAN. Велосипедные гетры Pearl Izumi Thermafleece Белые S XL New L M. MJBBF5 Молодежная бейсбольная бита 25/15 JBB Junior 2 3/4 Marucci F5 25/15 -10. Dynamic Sports Gear 1 футовый цветной шланг для пейнтбола Olive New, Exerpeutic 1000, усиленное магнитное упражнение лежа W, ручка «мяч» для кроссфита Pegbord Rock Climbing. Airsoft Tactical US Marine Military BDU Combat Boonie Hat Cap Digital Woodland, держатель для мыла Coghlan. Crampons Red Anti-Slip Ice Gripper Спортивные бутсы для походов и лазания по снегу.Life Gear Pro Series 500 Lumen CREE LED Heavy Duty Flashlight Water / Impact Resis. Детские очки для плавания для мальчиков и девочек Очки для плавания с защитой от запотевания Регулируемые затычки для ушей UX, стрельба из лука Магнитная стрелка Упор для левой руки Изогнутый лук по мишеням Стрелковое снаряжение Синий, DOMINGO SANTANA COVER MILWAUKEE BREWERS 2017 ОФИЦИАЛЬНАЯ ПРОГРАММА ИГРОВОЙ ПРОГРАММЫ ВЫПУСК № 25. Очень хороший каталог Weatherby 1966 «Weatherby .. лучшее в винтовках и прицелах », Honey OR Colorful NEW G-311 Бесплатная доставка GYES Кожаные ручки для руля с кольцом. PX4 StormNylon Подсумок для одного журнала Beretta Cougar 8000 СДЕЛАНО В США 9000, Great Lakes 3 «x 12» 2pk Blue Mirage Fl Синяя плазменная УФ-лента для рыболовной приманки, американская военная куртка для холодной погоды M65, стеганая подкладка M, L, XL EXC, бесплатная доставка Черный протектор резьбы 3/4 дюйма x 24.625 Long Made USA. Мужской капюшон на молнии с длинным рукавом из мериносовой шерсти Icebreaker, 200 г / м². 300-1000M Сверхпрочная плетеная леска Spectra 4/8 нитей 12-100LB США,

Фото галерея フ ォ ト ギ ャ ラ リ ー

Новая задняя пластина для молодежного футбола Gear Pro-Tec Z-Cool ZBP, задняя пластина для молодежного футбола New Gear Pro-Tec Z-Cool ZBP .

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *